DePIE

Design Primers for Protein Interaction Experiments

MANUAL

The manual pages will be updated continuously. Please send a mail to glu3@unl.edu to let us know if you have any comments or suggestions for how to improve DePIE.

System requirements

If you run DePIE on our biocore server at Bioinformatics Core Facility, University of Nebraska-Lincoln, through web, there are no additional systems requirements except those stated from the supplier of your web browser.

However, if you wish to download the program and run it on your local machine, you have to set up the Java running environment. You may want to consider using an IDE to help you. Java 2 SDK, Standard Edition v. 1.4, is available bundled with an IDE, the Sun™ ONE Studio 4, Community Edition (formerly known as the Forte^™ for Java^™, Community Edition). You can download this Sun ONE Studio bundle from the 1.4 download page. In addition, your computer needs a network connection and your web browser must be Java enabled. The browser must support Java JDK 1.1 or higher. Currently this JDK version is handled both by Microsoft Internet Explorer 4 and Netscape Communicator 4.06 or higher.

Principles for primer design

Primer selection criteria vary with experimental goals. However, there are key parameters:

1) Prediction of primer melting temperature at which it anneals to template DNA.

2) Elimination of primer self-complementarity and primer-dimer formation

The following conditions were applied to the selection of forward and reverse primers by DePIE. To maintain the flexibility of the program, but prevent inappropriate values from been entered, very loose limits on some of the variables have been included.

· Primer sequences should have a G/C content of between 35% and 65% of its total bases.

· Annealing temperature of each primer should match and be within a 45°C to 75°C range.

· The primer should be able to form "G/C" clamps, i.e., all primers should contain a GC-type sequence pair at their 3’-end. The bonds between G and C will facilitate the initiation of complementary strand formation by Taq polymerase acting at the 3’ end of the hybridized primer.

· At the 3’-end, there are not three or more G or C bases. This may stabilize nonspecific annealing of the primer.

· The primer fregment should contain no more than three contiguous base pairs of homology to itself or to its respective forward or reverse counterpart.

· The primer fregment should not have two or more hybridization regions with four or more contiguous base pairs of homology to its target sequence.

Besides the above conditions of primer selection, a length of 18 nucleotides of both forward and reverse primers was included in DePIE. Melting temperature (Tm) of the amplified region defined by a primer pair is computed from the standard equation in Bolton and McCarthy (PNAS 84:1390 1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press).

   TM = 81.5 + 16.6(log₁₀([Na+])) + 0.41*(%GC) - 600/length,

where [NA+] is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. The value for T(a) is calculated according to the following formula: T(a) = T(m) – 5, suggested by J. Sambrook, E.F. Fritsch, T. Maniatis in Molecular Cloning, A Laboratory Manual, Second Edition, p 11.46.

DePIE Pipeline

The pipeline of data processing is demonstrated in Figure 1.

Figure 1 Architecture of DePIE

Firstly, both the DNA and amino acid sequences are retrieved from GenBank using Entrez, a sequence retrieval system developed at NCBI (http://www.ncbi.nlm.nih.gov/). The amino acid sequence is then used to predict the structure and topology of the corresponding proteins with the PSORT program (http://psort.ims.u-tokyo.ac.jp/form1.html). The resulting HTML page generated by the PSORT server was then parsed to get information about the signal peptide, transmembrane domains and topology. Based on the information from the PSORT, the domains of interest, for example, domains within Endoplasmic Reticulum, are able to be determined, and their corresponding start and end positions are calculated. For each domain of interest, an 18-base nucleotide sequence is retrieved from each end of its corresponding nucleotide sequence. The start and end codons are added a priori to the 5’-end of the forward and reverse 18-base primers, respectively.

Protein interaction experiments usually require the cloning of PCR products into a plasmid for expression. It is thus necessary to have an option for the user to input short sequences with restriction sites that will be added priori to the 5’-end of primer segments. Since Gateway^TM provides an extremely fast and efficient route for functional analysis of genes, protein expression, and cloning, or subcloning of DNA fragments (http://www.lifetech.com), we set the restriction sequences used to build Gateway^TM clones by default. Their sequences are GGGGACAAGTTTGTACAAAAAAGCAGGCTCT for the forward primer and GGGGACCACTTTGTACAAGAAAGCTGGGT for the reverse primer, respectively. These default sequences can be changed when required.

Input format

The input for DePIE consists of NCBI protein accession numbers. The accession numbers can be entered manually in the web page or uploaded by file from a local computer (http://biocore.unl.edu/primer/primerPI.html). Note that each accession number should be entered per line. It looks like the following:

NP_055109
NP_009051
NP_009194

Adding restriction sequences to the primers

This is an optional step. By default the program will use the restriction sequences, which are used to build GATEWAYTM clones. These default sequences can be changed when required. Delete sequences in the text areas and input whatever restriction sequences that you want.

Setting Criteria for Primer Selection

If the user accepts the criteria discussed in the part of Principles for primer design, the program will take the defaults to find primers for you. Except you have a good reason to change them, otherwise we recommend you leave these parameters as defaults.

Output format

The output for DePIE includes the primer sequences, TM (thermodynamic melting point temperature), and target positions within the nucleotide sequence. Other output options include the nucleotide sequences, amino acid sequences, and TMP/protein topology predication results. The output is returned as a HTML file and a text file can be saved locally. Figure 2 is a sample output produced by DePIE.

Figure 2 A sample output produced by DePIE

Last update: March 2, 2003

DePIE
Design Primers for Protein Interaction Experiments
\| Home \| About \| DePIE \| Manual \| Links \| Download \| GNU License \| Contact \|
MANUAL The manual pages will be updated continuously. Please send a mail to glu3@unl.edu to let us know if you have any comments or suggestions for how to improve DePIE. System requirements If you run DePIE on our biocore server at Bioinformatics Core Facility, University of Nebraska-Lincoln, through web, there are no additional systems requirements except those stated from the supplier of your web browser. However, if you wish to download the program and run it on your local machine, you have to set up the Java running environment. You may want to consider using an IDE to help you. Java 2 SDK, Standard Edition v. 1.4, is available bundled with an IDE, the Sun™ ONE Studio 4, Community Edition (formerly known as the Forte^™ for Java^™, Community Edition). You can download this Sun ONE Studio bundle from the 1.4 download page. In addition, your computer needs a network connection and your web browser must be Java enabled. The browser must support Java JDK 1.1 or higher. Currently this JDK version is handled both by Microsoft Internet Explorer 4 and Netscape Communicator 4.06 or higher. Principles for primer design Primer selection criteria vary with experimental goals. However, there are key parameters: 1) Prediction of primer melting temperature at which it anneals to template DNA. 2) Elimination of primer self-complementarity and primer-dimer formation The following conditions were applied to the selection of forward and reverse primers by DePIE. To maintain the flexibility of the program, but prevent inappropriate values from been entered, very loose limits on some of the variables have been included. · Primer sequences should have a G/C content of between 35% and 65% of its total bases. · Annealing temperature of each primer should match and be within a 45°C to 75°C range. · The primer should be able to form "G/C" clamps, i.e., all primers should contain a GC-type sequence pair at their 3’-end. The bonds between G and C will facilitate the initiation of complementary strand formation by Taq polymerase acting at the 3’ end of the hybridized primer. · At the 3’-end, there are not three or more G or C bases. This may stabilize nonspecific annealing of the primer. · The primer fregment should contain no more than three contiguous base pairs of homology to itself or to its respective forward or reverse counterpart. · The primer fregment should not have two or more hybridization regions with four or more contiguous base pairs of homology to its target sequence. Besides the above conditions of primer selection, a length of 18 nucleotides of both forward and reverse primers was included in DePIE. Melting temperature (Tm) of the amplified region defined by a primer pair is computed from the standard equation in Bolton and McCarthy (PNAS 84:1390 1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). TM = 81.5 + 16.6(log₁₀([Na+])) + 0.41(%GC) - 600/length, where [NA+] is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. The value for T(a) is calculated according to the following formula: T(a) = T(m) – 5, suggested by J. Sambrook, E.F. Fritsch, T. Maniatis in Molecular Cloning, A Laboratory Manual, Second Edition, p 11.46. DePIE Pipeline The pipeline of data processing is demonstrated in Figure 1. Figure 1 Architecture of DePIE* Firstly, both the DNA and amino acid sequences are retrieved from GenBank using Entrez, a sequence retrieval system developed at NCBI (http://www.ncbi.nlm.nih.gov/). The amino acid sequence is then used to predict the structure and topology of the corresponding proteins with the PSORT program (http://psort.ims.u-tokyo.ac.jp/form1.html). The resulting HTML page generated by the PSORT server was then parsed to get information about the signal peptide, transmembrane domains and topology. Based on the information from the PSORT, the domains of interest, for example, domains within Endoplasmic Reticulum, are able to be determined, and their corresponding start and end positions are calculated. For each domain of interest, an 18-base nucleotide sequence is retrieved from each end of its corresponding nucleotide sequence. The start and end codons are added a priori to the 5’-end of the forward and reverse 18-base primers, respectively. Protein interaction experiments usually require the cloning of PCR products into a plasmid for expression. It is thus necessary to have an option for the user to input short sequences with restriction sites that will be added priori to the 5’-end of primer segments. Since Gateway^TM provides an extremely fast and efficient route for functional analysis of genes, protein expression, and cloning, or subcloning of DNA fragments (http://www.lifetech.com), we set the restriction sequences used to build Gateway^TM clones by default. Their sequences are GGGGACAAGTTTGTACAAAAAAGCAGGCTCT for the forward primer and GGGGACCACTTTGTACAAGAAAGCTGGGT for the reverse primer, respectively. These default sequences can be changed when required. Input format The input for DePIE consists of NCBI protein accession numbers. The accession numbers can be entered manually in the web page or uploaded by file from a local computer (http://biocore.unl.edu/primer/primerPI.html). Note that each accession number should be entered per line. It looks like the following: NP_055109 NP_009051 NP_009194 Adding restriction sequences to the primers This is an optional step. By default the program will use the restriction sequences, which are used to build GATEWAYTM clones. These default sequences can be changed when required. Delete sequences in the text areas and input whatever restriction sequences that you want. Setting Criteria for Primer Selection If the user accepts the criteria discussed in the part of Principles for primer design, the program will take the defaults to find primers for you. Except you have a good reason to change them, otherwise we recommend you leave these parameters as defaults. Output format The output for DePIE includes the primer sequences, TM (thermodynamic melting point temperature), and target positions within the nucleotide sequence. Other output options include the nucleotide sequences, amino acid sequences, and TMP/protein topology predication results. The output is returned as a HTML file and a text file can be saved locally. Figure 2 is a sample output produced by DePIE. Figure 2 A sample output produced by DePIE Last update: March 2, 2003